Introduction to miRNA primer design process

The naming principles of MiRNA can be summarized as follows:

A system name consists of three parts, namely the species, the microRNA category, and the serial number. The three are connected by short lines. Species are generally represented by three lowercase letters, such as hsa, mmu, and rno representing humans , mice, and rats, respectively. MicroRNA category refers to the named microRNA is pre-miRNA or mature miRNA. The pre-miRNA is represented by mir and the mature miRNA is represented by miR . The serial number is an Arabic number representing the order of microRNA discovery. In general, the smaller the number, the earlier it is discovered.

Pre-miRNA located in different parts of the genome, but produce the same mature miRNA sequence number is added after the short-term and Arabic numerals to distinguish, such as hsa-mir-7-1, hsa- mir-7-2, hsa-mir-7-3 .

Some pre-miRNAs can produce two mature miRNAs . The mature miRNAs corresponding to the 5' and 3' sequences of the pre-miRNA stem-loop structure were suffixed with -5p and -3p , respectively, to distinguish them, such as rno-miR-325-5p and rno-miR-325-3p .

If the relative expression levels of the two mature miRNAs matured from the same pre-miRNA are known, the high expression level is suffixed with *, such as hsa-miR-17*, which is higher than hsa-miR-17 .

For a difference of only 1 - 2 bases mature miRNA, a lower case letter suffix added to show the difference, such as hsa-miR-19a, hsa- miR-19b.

To better distinguish miRNAs from siRNAs and other non-coding small RNA or mRN *** segments , scientists have named miRNAs as follows:

(1) miRNA is abbreviated as miR-No., its gene is abbreviated as mir-No. such as miR-21 ;

(2) In highly homologous miRNA No. subsequently added letters (lower case, generally starting from a) as miR-199a and miR-199b;

(3) miRNAs with the same mature sequence transcribed from DNA sequences on different chromosomes are followed by Arabic numerals to distinguish them , such as miR-199a-1 and miR-199a-2 ;

(4) If the two arms of a precursor are separately added to produce miRNA , according to the cloning experiment, add "*" to the miRNA with lower expression level , such as miR-199amiR-199a* , or name it as follows, miR-142 -5p ( may also be named miR-142-s , which means processing from the 5' end arm ) and miR-142-3p ( also named miR-142-as , which means processing from the 3' end arm ) ;

(5) Place the species abbreviation before the miRNA , such as hsa-miR-195 ;

(6) Identify the miRNAs found before the naming rules , such as let-7 ,

(Design primers only see if there is a miR- a, b after the Arabic numerals , and has little relationship with other numbers and letters)

Primer design for microRNA
The primer was designed with hsa-miR-145 as an example. The mature sequence is: GUCCAGUUUUCCCAGGAAUCCCU
Reverse primer: each reverse primer has a fixed sequence that forms a stem loop.
The fixed sequence is: 5 , -CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG-3 ,
TGGTGTC GTGGAGTCG
After this sequence plus eight bases, which bases are eight hsa-miR-145 from behind the reverse complement sequence number eight bases is the reverse complement GAAUCCCU: AGGGATTC, the resulting reverse The sequence of the primer is
5 , -CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTG AG AGGGATTC -3 ,
Forward primer: Each forward primer also has a fixed sequence, and the fixed sequence is: ACACTCCAGCTGGG
After this sequence is added to the mature base , except for the remaining six base sequences , the mature body is removed from the next six bases and the sequence is: GUCCAGUUUUCCCAGGA , U is changed to T , and the last sequence is:
5 , -ACACTCCAGCTGGGGTCCAGTTTTCCCAGGA -3 ,
URP : unified reverse primer, also a fixed sequence, TGGTGTCGTGGAGTCG
U6 Primer F-CTCGCTTCGGCAGCACA , R-AACGCTTCACGAATTTGCGT
Instructions:
1 Reversal of primers: Mix of all miRNA reverse primers to be done , each 10 μl
2PCR primers: 50 μl of system, 30 μl of water, 10 μl of forward primer, 10 μl of URP

Self-learning miRNA primer design:   

  A hairpin structure:   GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC- ( Detection of   Let-7a   microRNA   By   Real-time   PCR   In   Gastric Carcinoma ) Tm value 87.5 °C

Design example:

>hsa-let-7a MIMAT0000062

UGAGGUAGUAGGUUGUA UAGUU

let-7aP RT : GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC AACTA

let-7aPf: GCCGC TGAGGTAGTAGGTTGTA 66.5

let-7aPr: GTGCAGGGTCCGAGGT (universal) 55.1 seems to have a dimer

This is my own interception:

>hsa-miR-16 MIMAT0000069 UAGCAGCACGUAAAUAUUGGCG

Stem loop primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCCAA

Upstream primer: TAGCAGCACGTAA (21nt , Tm value 65.5 °C, GC content 52.4%)

  Downstream primer: GTGCAGGGTCCGAGGT (generic) (16nt, Tm values of 55.1, GC content 68.8%)?

There is also CGCCGCCCAGTGTTCAGA, which has no dimer (the article on breast cancer). This should be his mistake, it should be his upstream primer.

Flase priming

Refers to primer sequence extension caused by non-template sequences during PCR .    Generally, the 3' end of the primer binds to the non-template sequence, and the Taq enzyme is caused by DNA polymerization along the sequence .   Hazard: 1. Non-specific products are produced. In most cases, due to the lack of false triggering on the opposite side, the product only grows linearly, and the rate is much smaller than the exponential growth of the PCR- initiated product, which does not affect PCR , but once the opposite occurs. False triggering, false triggering products also exponentially increase, resulting in non-specific products, which are often the cause of PCR failure

2. destroyed primers false trigger in the 3 primer 'end of an unexpected base unknown, so that primer 3' end is no longer complementary to the template, the result is that although the primer and template binding but failed to elicit normal PCR products, which The result is a large amount of disruption of the primers, while competing for primer binding sites, resulting in a decrease in normal PCR products.

Reason: The specificity of the primer is not good (the homologous sequence of the template, the repeat sequence), the annealing temperature is low, and the template forms a high-order structure (stem ring, hairpin, groove) under certain conditions, and the high-order structure of the primer ( Hairpin

Dimer dimer

>hsa-miR-126 MIMAT0000445 UCGUACCGUGAGUAAUAAUGCG

Stem loop primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT

Upstream primer: GGCTCGTACCGTGAGTAAT (this shortest sequence that can be blasted out, but he has hairpin structure and dimer formation, headache)

Downstream universal primer: GTGCAGGGTCCGAGGT

1. Reverse transcription of the stem-loop primer: Adding 6 bases complementary to the 3 ' end of the microRNA in a stem-loop structure , but there are also reports that the base complementary to the target miRNAme cannot be less than 7 , entangled, and What is the focus on the choice of this stem ring structure? For example, which of the following two stem-loop structures is good ? 1) GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC 2) GTCGTATC CAGTGCGTGTCGTGGAGT CGGCAATTGCACTGGATACGAC

1. We usually use 6 bases, which can be expanded. Sometimes the parameters may increase to 7-8 depending on the situation . As long as there is no base that overlaps with the forward primer , the stem ring seems to have two kinds. We use CAGAGCCA .
2. Realtime PCR forward primer generally takes the first 14 bases of the target sequence 5' , sometimes it may be reduced to 12 , and then supplements 6 to 8 free bases according to GC content and Tm level.

Design of miRNA - 421 Primer Sequence

For each one miRNA, 3 primers were designed: a reverse primer specific for reverse transcription, a forward primer, and a common

Reverse primer .

Each specific reverse transcription primer sequences are presented with the fixed section 1, can form a stem-loop, past 36 nuclei acid sequence of its 5 'end is a

The fixed, fixed sequence is: 5 ' -CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG - 3 ', which forms an 8- nuclear acid ring

Core structure 20 and past the stem acid, 3 'end of the past six to eight cores and the reverse complement of the acids miRNA, named 421RT6, 421RT7,

421RT8 (primer sequence is shown in Table 1 ) .

Forward primer 25 about a core 32 past acids at the 3 'end of the core 18 has a former 11 with the corresponding acids complementary to a miRNA. Each forward primer also

With a fixed sequence of 1 segment, the fixed sequence is: ACACTCCAGCTGGG. Add the miRNA mature sequence after this sequence, and remove the 5 ' end.

The remaining nucleotide sequence of the 3 'end of the past six to eight cores acid, into the U to T because we designed the forward primer comprises a mature mir respectively 421

Sequence 5 'end 18 , 19 nucleotides, hence the names 421F18 , 421F19.

Common downstream primer (Genera1 ReVerSe, GR) 23 nt , wherein the core 18 past the corresponding acid moiety specific stem-loop reverse primer. Tong

See Table 1 for the downstream primer sequences.

Tab1e 1 Primers for reverse transcription and f1uorescent quantification PCR

GeneS NameS sequenCe Pr0duCt 1ength

mi421RT 421RT6 5 ' -CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG GCGCCC - 3 '

421RT7 5 ' -CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG GCGCCCA - 3 '

421RT8 5 ' -CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG GCGCCCAA - 3 '

mi421F 421F18

421F19

5 'One ACACTCCAGCTGGGATCAACAGACATTAATTG - 3 '

5 'One ACACTCCAGCTGGGATCAACAGACATTAATTGG - 3 '

mi421R GR 5 'One TGGTGTCGTGGAGTCG one 3 '

U6 U6 - F

U6 - R

5 ' -CTCGCTTCGGCAGCACA - 3 '

5 'one AACCGCTTCACATATTTGCGT one 3 '

Veterinary Drug Preparation For Pets

Medicine for pets.,including antibiotics, hormones, feed, vitamin nutrients, etc.

Veterinary drugs refer to substances (including drug feed additives) used for prevention, treatment, diagnosis of animal diseases or purposeful regulation of animal physiological functions.

Veterinary drugs can be roughly divided into four categories: â‘  general disease prevention and treatment drugs; â‘¡ Drugs for prevention and treatment of infectious diseases; â‘¢ Drugs for prevention and treatment of internal and external parasitic diseases; â‘£ (including growth promoting drugs). Except for the biochemical immune products (vaccine, vaccine, serum, antitoxin, toxoid, etc.) for the prevention and treatment of infectious diseases, as well as special veterinary drugs for livestock and poultry parasitic diseases and growth promoting drugs, the rest are the same as those for human use, but the dosage, dosage form and specifications are different. It has long been widely used in the prevention and control of livestock and poultry diseases.
More than 20 kinds of veterinary drugs are commonly used, such as analgin, amoxicillin, florfenicol, ceftiofur, oxytetracycline, chlortetracycline, bacitracin, salinomycin, monensin, colistin, etc. 60% of antibiotics were used in chemotherapy; 40% is used as feed, which can not only prevent infectious diseases, but also promote the growth of livestock and poultry and improve the utilization rate of feed.
Among the Antiparasitic Drugs, in addition to the common anti helminth drugs (mebendazole, levamisole, thiadiazine, etc.), anti schistosomiasis drugs (antimony agent, nithiocyandiamide, praziquantel, etc.) and anti tapeworm drugs (niclosamide, etc.), the special anti Fasciola hepatica drugs (nitrochlorophenol, trichlorobenzole, etc.), Trypanosoma, and pyroplasmosis drugs (antracel, suramin, chloramphenicol, etc.) for livestock and poultry are also used Imidacloprid and other insecticides (organophosphorus insecticides). A macrolide antibiotic was found to have a significant killing effect on parasites such as gastrointestinal nematodes, Dermatophagoides, blood sucking lice, especially Sarcoptes scabiei. Coccidiosis is a serious threat to the safety of chickens and rabbits. There are more than 30 kinds of commonly used anticoccidial drugs, including synthetic drugs (such as chlorobenzoguanidine, changshanone) and antibiotics (such as monensin, salinomycin), which are often used alternately.
Biochemical immune products are mainly used to prevent animal anthrax, brucellosis, anthrax, salmonellosis, and a variety of viral infectious diseases.
Injections are commonly used in veterinary drug preparations, but their specifications are several times larger than those for human use. Oral veterinary drugs are usually in powder or microcapsule form, as feed additives, mixed into the feed for free feeding of livestock and poultry. Anabolic hormone can increase the benefit of raising livestock and poultry. It is mainly made into implant for subcutaneous implantation. Transdermal preparations and medicated baits for aquaculture are emerging.

Our business covers Africa, the Middle East, Central Asia and Southeast Asia.
North Africa Egypt, Libya, Tunisia, Morocco, Algeria.
East Africa is Ethiopia, Somalia, Kenya, Tanzania, Uganda, Burundi, Rwanda and Seychelles.
West Africa usually includes Mauritania, Senegal, Gambia, Mali, Burkina Faso, Guinea, Guinea Bissau, Cape Verde, Sierra Leone, Liberia, C ? te d'Ivoire, Ghana, Togo, Benin, Niger, Nigeria, etc.
South Africa is South Africa, including Zambia, Malawi, Zimbabwe, Botswana, Swaziland, Lesotho, Mozambique, Republic of South Africa, Namibia, Madagascar, Comoros, Mauritius, Reunion Island, France, St. Helena and ascension.
Central Africa includes the Central African Republic, Chad, Cameroon, Equatorial Guinea, Gabon, the Republic of Congo, the Democratic Republic of Congo, Sao Tome and Principe.
Central Asia refers to the inland region of Central Asia: Kazakhstan, Uzbekistan, Kyrgyzstan, Turkmenistan, Tajikistan and Afghanistan.
Southeast Asia: Myanmar, Thailand, Cambodia, Laos, Vietnam, Philippines, Malaysia, Singapore, Brunei, Indonesia and Timor Leste.
Countries and regions in West Asia include Saudi Arabia, Iran, Iraq, Kuwait, UAE, Oman, Qatar, Bahrain, Turkey, Israel, Palestine, Syria, Lebanon, Jordan, Yemen, Cyprus, Georgia, Armenia and Azerbaijan.
North African countries and regions include Egypt, Libya, Tunisia, Algeria, Morocco, Madeira Islands, Azores Islands and Western Sahara.

Tablet Veterinary Medicine,Injection For Pets,Granisetron Hydrochloride Injection,Vitamin Nutrients For Pets,Antibiotics For Pets,Powder for pets,Primix for pets,Tablet for pets

Shandong Unovet Pharmaceutical Co.,Ltd. , https://www.unovetcn.com